Population Health Assignment Example | Topics and Well Written Essays - 2250 words

Population Health - Assignment Example Article by Saxe, (2011) indicates that in order to win the war against childhood obesity that has been on the increase, it is important to involve the whole community in the project from the parents, to the physicians and anyone else in between. In this article, the general assumption is that by the community becoming involved rather than purely relying on only one party, the children will be protected from eating unhealthy food and ensure that they carry out regular physical exercises and not only sit playing video games at all times. The other article discusses how nurses should rom the time children are born advice on healthy dietary measures at each and every age. This will help solve the issue from the root cause Berkowitz & Borchard, (2009). In this article, the authors explain how women after birth listen to the advices provided by nurses and especially the first time mothers and follow that advice to the letter. Nurses are quite knowledgeable on the best diets for the children at each stage and incorporation of physical activities and hence are in the best position to disseminate this information to the parents. Obesity is on the rise and the policies that have been established to end it have not been effective. In order to get a long lasting and effective solution, it is important for the stakeholders who include teachers and parents to stock their houses and classrooms with only healthy snacks. The other step is to ban the sale of sweets and sugary beverages to children without adult supervision as well as have constant physical exercises in school and at home. The objective should aim at reducing significantly the amount of sugary beverages and unhealthy food the susceptible population are engaging in. These will ultimately improve their diet. It also aims at encouraging healthy lifestyle through physical exercises and

Microbiological effects from baby bottle misuse Research Paper

Microbiological effects from baby bottle misuse - Research Paper Example Moreover, the inherent immune elements in milk offer defense against infectivity. There are oligosaccharides present in the milk that avert accessory of normal respiratory micro-organisms like Streptococcus pneumoniae and Haemophilus influenzae (Gurtler, Kornacki & Beuchat, 2005). Misuse of bottle feeding is risky in the sense that the bottle formulae lack the Glycosaminoglycans which is normally present in the natural breast milk that averts attachment pathogens hence minimizing the risk of transmission. It must be noted that human milk administered through the normal breastfeeding adds up to inherent immunity. Long formula fed babies have the risk of contaminating and being infected with Giardia lamblia, H influenzae and the B streptococci, S epidermis and other micro-organisms such as the respiratory syncytial virus (RSV) (Gurtler, Kornacki & Beuchat, 2005). Misuse of baby bottle can also lead to infection of the lower respiratory tract. According to analysis of 7 group research o f healthy term babies in affluent locations, it was established that babies who were bottle-fed experienced a 3.6-fold higher risk of being hospitalized for infection of the lower respiratory tract in the initial year of their existence in comparison with babies who were wholly breastfed for a period of over 4 months. These research comprised modification for socioeconomic condition and parental smoking. Many of the infants hospitalized from respiratory infections arise from the respiratory syncytial virus. The human milk contains lipids which tend to have an antigen against RSV. Moreover, multifaceted researches also claim that bottle fed infants or formulated infants have a higher risk of contracting gastrointestinal pathogens and diarrhea. Similarly, 14 group studies meta-analysis established that infants who were bottle fed or formula fed were 2.8 times more probably to get infected with gastrointestinal pathogens compared to those who were totally breastfed (UNCF, 2003). Findin gs from PROBIT (promotion of breastfeeding intervention trial) reveal that infants who were used in the control experiment were 1.7 times more probably to get infected with gastrointestinal infection compared to those used in the intercession group. In this research 31 maternity hospitals were randomized to the Baby Friendly Hospital Initiative (BFHI) and a set of proof-found activities accommodating of breastfeeding, against the normal care. The entire 17,046 babies in the PROBIT research were breastfed, entirely at 3 months. It was found that 6.4% of the control studies were totally breastfed in comparison with the 43.3% of the intercession babies (UNCF, 2003). According to various epidemiologic researches it is suggested that infants and children who are exclusively bottle-fed on formula products are more probably to develop a condition of obese or develop type II diabetes. Furthermore, a meta-analysis study reveals that formula feeding among the infants is also related to the 1. 6 fold risk of the type 2 diabetes in comparison to the exclusively breast-fed children. Other studies have also claimed that a higher risk of diseases related to cardiac vacuoles inclusive of the high pressure of the blood and reduced favorable lipid profile also looms for children who are formula-fed even though the literature varies (Drudy, et al., 2006). Scholars have suggested that numerous interventions to describe these

HR Strategic aspects of the labour market and Managing organisational performance Essay Example for Free

HR Strategic aspects of the labour market and Managing organisational performance Essay The economic events occurring during the last two decades provide indications and evidences that the area of human resourcing has significantly changed in response to the emerging complexities of the discipline. Perhaps, among the primary components of corporate organization, the dynamics of human resourcing appear to be the most challenging as well as complex. Experts in the area of Human Resource Management (HRM) invariably agree that the surging demand for a new organizational role for the human capital. Even the usually common terminologies used to describe the HRM processes, such as labor contracting, training and development, performance evaluation, have been recycled to outsourcing, learning and growth or performance management systems. Many even replaced, such as personnel to human resource to human capital, to describe in more sophisticated way, the new character of human resourcing. Still, HRM practitioners are of the opinion that changes will continue to pervade the HR area and may soon take or evolve into new competencies again. Torrington’s Views: The HRM discipline and the Labour market Torrington presents the burgeoning labour issues confronting many organizations as propounded by theorists and practitioners. Indeed, the complexities of human resourcing are invariably revealed in the documented HR practices compiled by the author, who has been keenly observing that the area of human resource management is beginning to undergo a form of transformative process where the task s, positions and the organization virtually mutates into its more sophisticated form. Based on data provided by the author and taken from a report, there is a general shortage of workers especially the young sector. In the area of healthcare, the National Health Service (NHS) is spending ? 1bn annually on temporary, agency and locum staff. According to Laing and Buisson, well known heathcare analysts, the demand for agency staff is expected to increase across public and private healthcare sector in response to the long-standing manpower shortages in practically every healthcare occupation. The author adds that the size of the market for manpower has risen by more than four times during the two decades commencing from 1992. Even the NHS had to triple their budget expenditures during the same period. Torrington estimates this sector is worth ? 2. 4bn in the market. However, the core of the problem has shifted to the quality of care that many temporary staff provide, thus the decision to reduce manpower outsourcing, Here, the need to get better deals from agencies is becoming paramount as new alternatives of human resourcing in this sector is being addressed. The author concludes by proposing an appropriate response system through flexible staffing solutions. Torrington highlights the strategic aspects of resourcing to respond effectively to the critical messages demanded and manifested by the labor market trends. Here, he analyzes the need to adopt certain flexible resourcing choices that will focus attention either to the ready-made or home grown human capital. The labor market trends bespeak of the dilemma faced by the human resourcing industry in general. A number of recommendations are provided to address this set of HR issues – the retention strategy. The retention indicators point to a disturbing trend at the charts. The issue of retention and its corresponding techniques and strategies has been brought into the open as a result of the need to assuage the cost of transfers, job and even career shifts. The author brings the issue of turnover rates and trends as indicative of HR instability in many sectors while exacting some forms of costs on the organization as a result of new rounds of resourcing and the need to adopt staff retention strategies. Torrington insists that organization strategies versus HR strategy issues not only should be HR-driven but primarily must mutually provide a perfect fit. The author discloses the strategic aspects of performance how these are driven by HR policies and processes as practiced. This is implied to mean that a change in perspective be made in the human resourcing function: from taking control of the employment processes to a more significant HR function of managing performance. True enough, this shift in focus may have been long wanted to smoothen human capital transitions to work excellence. This further suggests that efforts are better spent on ensuring that performance management becomes the primary driver of the HR function. A number of firms have found better insights into this form of HR shift considering that the new HR performance processes adds relevance and more meaningful roles for HR theorists and practitioners rather than just the documentary and aspect legalese of human resourcing. The author proposes the adoption of a performance management system that translates into organizational performance anchored on the knowledge and learning processes as HR initiatives. Here, the proactive roles expected of the HR practitioners are deemed directed towards gradually converting the company into a learning organization where the human capital competencies are planned, managed and nurtured. Performance management system indeed is a critical need as with the 360 degree feedback system. Conclusion Torrington proposes a two-dimensional performance appraisal system based on individual and team perspectives. He emphasizes management of employee performance guided towards organizational and personal goals and objectives and an objective appraisal system to measure extent of accomplishment based on target setting. A sequential and step-by-step approach is propounded with a component critique system based on an overarching 260 degree feedback system. A comparison and contrasting view of performance management system (PMS) and its environment of procedures indicate that the PMS has and is being widely used in organizations out to harness the potentials of its people. The degree of effectiveness indicates the variability of conceptualization and implementation, but nonetheless removes the major irritants in people management that ultimately affect the relationship as well as the performance dimensions of each of the component of the human capital sponsored primarily by senior management. Thus, the proactive nature of the PMS approach entitles it to wider adoption and desirability among organizations aiming to address many of its human resourcing issues. Subject 2 Performance Management System: Linking Organizational Goals Torrington outlines the essential factors in managing organisational performance showing how a Performance Management System (PMS)links to organisational goals. Concrete and abstract benefits and disincentives are identified and benchmarked with industry practices guided by the universal principles and theories of performance management. As practiced, performance management systems commence from the goal and target setting based on the requirements of the job. Here, employees and workers are clarified in the objectives of their positions, the requisite competence, and the learning and growth perspectives if the job as well as the compensation based on how the organization assesses the relative important of the task. The use of the PMS has been tested widely and has proven to be more effective than the traditional evaluation system. This is because of the inclusion of a compendium of measures that ensures that organizational goals are aligned with the specific tasks assigned to the employee. From the targets, agreements on the degree and how these targets are achieved under quality processes are laid down and the PMS target setting contract is accomplished. Thus, the use of the PMS allows the following benefits to accrued to both the worker and the organization: among others, expectations are clear and scope and limitations of the jobs are understood by both sectors; employees can clearly predict and manage their own levels of performance based on targets as well as the needed support to accomplish the tasks; there is an objective system of evaluation and appraisal that removes subjectivity and abstract judgments; when provided with an incentive and reward systems, PMS becomes effective as a tool and basis of rewards and incentives; and, there is a better working relationship between the worker and his superior based on earlier agreements and covenants. Likewise, PMS considers possible constraints and limitations on both sides, thus alternative measures are agreed for the degree of performance resulting from the occurrences of such constraints and impediments. For the organization, the benefits are clear in terms of stronger motivation on the worker; budgeting can be integrated into the system through measurable and appropriate inventive and rewards system; the subsequent appraisal and evaluation system allows for an ideal atmosphere for the discussion of the evaluation and appraisal results to encourage future performance based on areas that additionally needed reinforcement and support. In addition, PMS encourages both individuals and teams to be evaluated based on targets that are aligned with the organizational goals. On the other hand, the disadvantages of adopting a Performance Management System (PMS) includes the requirement for a more detailed procedures and measurement system that may prove to be too elaborate and complex for the worker to understand and appreciate. Likewise, the process of documentation in support of the performance is considered difficult and tedious. Further there is no assurance that performance can indeed by achieved as there may be unforeseen circumstances not considered during the target setting completed before the start of the performance period. (Noe, Hollenbeck, Gerhart, Wright, 2008) Nonetheless, there is a need to study the organizational culture on whether the latter would help the system or otherwise. Conclusion Taking into account the benefits and disadvantages of Performance Management Systems (PMS), the absence of a more measurable, objective and comprehensive system of measuring and evaluating performance is non-existence despite the presence and utilization of good measuring tools and instruments. This is the complexity of the new HResourcing strategy that allows greater flexibility and uniqueness in the approach to managing performance. On the overall, the rationale for adopting PMS far outweighs the need to ignore the benefits provided by this new system. Often, the major constraint in adopting PMS is whether the organizational culture would allow such a change in the system. Thus, the efforts may indeed be tedious, but nonetheless, there is strong desirability in the system that will be more advantageous to every stakeholder in the PMS environment system.

Antimicrobial and Antioxidant Activity: Secondary Metabolite

Antimicrobial and Antioxidant Activity: Secondary Metabolite Natural products remains a consistent source of drug leads with more than 40% of new chemical entities (NCEs). It has become imperative to explore microorganisms for NCEs and lead drug molecules for the drug discovery. Keeping this in view bioprospecting of microorganisms is carried out from every possible source, including extreme environments like ocean beds, geothermal vents, cold desserts etc., in search of novel strains with promising bioactivities. During the past two decades it has been observed that much wealth of microbial biodiversity with novel biochemistry and secondary metabolite production resides in endophytes. So far, numerous bioactive molecules have been isolated from endophytic fungi. An important step towards tapping their potentials for human welfare including drug discovery and sustainable agriculture, it is very essential to isolate endophytes from various ecological niches. Among the endophytes lichen associate fungi are unique organisms that have potential bioactive properties including, antibiotic, antioxidant, antiviral, anti-inflammatory, analgesic antipyretic, anti-proliferating and cytotoxic activities. In this study endolichenic fungi was isolated from crustose lichen Lecanora sp. collected from Horsley Hills, Andhra Pradesh. The isolated endolichenic fungi was identified as Talaromyces tratensis on the basis of ITS4and ITS5 ribosomal gene sequences. The fermented broth is potential source for anti-metabolites. The metabolites crude active against gram positive, gram negative bacteria and fungal pathogens. The most distinguished free radical scavenging activity was observed for Ethyl acetate extract of fungal mycelium. The EC50 values based on the DPPH (1, 1- Diphenyl-2- Picrylhydrazyl), Hydrogen peroxide and Nitric oxide were 45.50 ±0.01, 32.61 ±0.06 and 66.54 ±0.01 respectively. Keywords: Antioxidant activity, Crustose Lichens, Endolichenic fungi and Talaromyces tratensis The Name endolichenic fungi was introduced by Miadlikowsk in 2004 [1]. Endolichenic fungi signifies a vital ecological group of species that form close associations with lichens [2], which lives as endosymbiotic micro fungi in the thallus of lichens and resemble to endophytic fungi live in the intercellular spaces of the plant hosts [3-5]. To date about 100,000 fungal species are identified even if distant more than one million are expected. The diversity of species and the variety of their habitations, some of them unexplored, this lead to be fungi as a rich source of novel metabolites [6]. Besides that Endolichenic fungi are untapped and new treasured source for bioactive metabolite products [5, 7] Only a few investigations have been reported on the bioactive metabolites of endolichenic fungi, but they have shown great potential to be a new source for structurally diverse and biologically active natural products [5, 8-10]. Secondary metabolic products of endolichenic fungi shows di stinct bioactivities like antimicrobial [5, 9, 11], antiviral [12], antioxidant [13-14] anticancer and cytotoxic [7, 9-10, 13-16]. These bioactive compounds have great prominence in development of pharmaceutical drugs, nutraceuticals and agrochemicals. The present study was carried out to investigate antimicrobial and antioxidant activities of endolichenic fungi Talaromyces tratensis inhabiting the lichen Lecanora spp. Collected from Horsley hills, Andhra Pradesh, India. This research was aimed determining the antimicrobial and antioxidant activity of secondary metabolites present in the ethyl acetate (EtOAc) extract of Talaromyces tratensis fermented in potato dextrose Broth (PDB) and their potential for the production of bioactive compounds. MATERIALS AND METHODS Sample Collection The lichens were collected from Horsley hills (13.66 °N 78.40 °E), 147 km of a part of Sheshachalam Hills range, Andhra Pradesh. The lichens were located at an altitude of 1,290m above sea level. The lichen samples were collected from different substrates and transported into the laboratory in sterilized paper bags. Isolation of Endolichenic Fungi The fungi Talaromyces tratensis isolation was carried out by modified method of Guo et al.,2003 and Kannagara et al.,2009 [17-18]. Healthy lichen thalli were cleaned in running tap water to the remove dust particles, litter and then washed with milli-Q watter. The surface sterilized by consecutive immersion for 4min in 2% Sodium Hypochlorite, with Hydrogen peroxide for 2min followed by immersed in 30 s in 75 % ethanol. The thalli surface were dried with sterile filter papers and aseptically cut into small segments (0.5 ÃÆ'- 1 cm) and were evenly placed in each 90mm Petri dishes containing Potato Dextrose agar (PDA) with Streptomycin Sulphate (50ÃŽÂ ¼g/ 100ml). The PDA plates were sealed with Paraffin film and incubated at 28 °C for 7days. Fungi grown from each lichen segment and make into pure cultures. Slides containing pure cultures were prepared using the slide culture method [19] and identified using identification keys [20]. The growing fungi Talaromyces tratensis were sub -cultured on PDA. Molecular identification of the isolated endolichenic fungus Genomic DNA isolated in the pure form from the fresh biomass of Endolichen fungus by CTAB (N-cetyl N,N, Ntrimethyl -ammonium bromide) method [21], the Identification of isolated pure strain of the endolichenic fungus was carried out using a molecular biological protocol by genomic DNA extraction, internal spacer transcribed (ITS) region amplification and sequencing. The ITS region of rDNA was successfully amplified by PCR was set up with ABI BigDye ® Terminatorv3.1 cycle sequencing kit and using fungal universal primers ITS4 (5à ¢Ã¢â€š ¬Ã‚ ² TCCTCCGCTTATTGATATGC 3à ¢Ã¢â€š ¬Ã‚ ²) ITS5 (5à ¢Ã¢â€š ¬Ã‚ ² GGAAGTAAAAGTCGTAACAAGG 3à ¢Ã¢â€š ¬Ã‚ ²) [22]. It was sequenced in both directions using the respective PCR primers. For this purpose, the Big Dye terminator sequencing kit (Version 3.1, Applied Biosystems) and an ABI 3100 automated DNA sequencer (Applied Biosystems) were used. Raw Gene sequence was manually edited for inconsistency and the predicted sequence data were aligned with public available sequences and analyzed to reach identity by using NCBI BLAST ® (http://www.ncbi.nlm.nih.gov/blast/). Fermentation and extraction: The fermentation was carried out in Erlenmeyer flasks using a complex medium consisting of Potato Dextrose Broth (HIMEDIA Laboratories). The flasks containing 200 mL fermentation medium were inoculated with 5 days old actively growing T. tratensis mycelial agar discs (6mm), the Flask cultures allowed for inoculum development and fermentation at 28 ±2 °C, pH 7.0 with orbital shaking at 120 rpm [23]. After 14days of Fermentation the fungal biomass was separated with Whatman No.1 filter paper from fermented broth and filtered broth was allowed to liquid-liquid separation with EtOAc (1:1 ratio) in a separatory funnel. After this procedure, the organic solvent was evaporated under reduced pressure to dryness to yield an EtOAc extract [24]. Antibacterial Activity: To evaluate Antibacterial activity of T. tratensis EtOAc crude extract tested against gram positive (Bacillus cereus and Staphylococcus aureus) and gram negative bacterial pathogenic strains (Escherecia coli, Pseudomonas fluorescence, Klebsiella pneumonia and Salmonella typhi) by agar well diffusion method [25-26]. Antibacterial activity was expressed as the percent inhibition (%) of bacterial growth using the following formula C-T/C X 100. Antifungal activity The antibacterial activity in in vitro was dilution determined against the pathogenic fungi Fusarium oxysporium, Colletotrichum capsisi and Aspergillus niger by poison food technique [27]. 1 ml of tenfold of the EtOAc extracts were mixed with molten PDA separately and then poured into Petri dishes and control PDA plates supplemented with sterile distilled water. A mycelia disc of tested pathogens was transferred on the center of both test and control plates and incubated for 5days at 28 °C. The mycelial radial was measured and the percentage of inhibition was expressed by using following formula T1 T2/ T1 X 100. Screening for Antioxidant activity DPPH Assay: Free Radical-scavenging activity of T. tratensis extract against stable 2, 2 diphenyl 2 picrylhydrazyl hydrate (DPPH) was determined by the slightly modified method of Prior R.L. et al., 2005 [28]. DPPH reacts with an antioxidant compound which can donate hydrogen and reduce DPPH. The change in colour (from deep violet to light yellow) was measured at 517 nm on a UV visible light spectrophotometer. The solution of DPPH in methanol 0.2mM was prepared fresh daily before UV measurements. One milliliter of this solution was individually mixed with ethyl acetate extracted crude sample of T. tratensis (25mg, 50mg, 100mg and 200mg). The samples were kept in the dark for 15 minutes at room temperature and the decrease in absorbance was measured. The experiment was carried out in triplicate. Radical-scavenging activity was calculated by the following formula Inhibition Percentage % = [(à °Ã‚ Ã‚ Ã‚ ´blank à ¢Ã‹â€ Ã¢â‚¬â„¢ à °Ã‚ Ã‚ Ã‚ ´sample)]/à °Ã‚ Ã‚ Ã‚ ´blank] ÃÆ'- 100 Whereà °Ã‚ Ã‚ Ã‚ ´blank is the absorbance of the control reaction and à °Ã‚ Ã‚ Ã‚ ´sample is the absorbance in the presence of purified molecules Determination of Antioxidant Activity by Reducing Power Measurement The reducing power of the extract was determined according to Oyaizu 1986 [29] with slight modifications. An amount of 25mg, 50mg, 100mg and 200mg of extracted sample was added to 2mL of 1% potassium ferricyanide. After incubating the mixture at 50 °C for 30 min, during which ferricyanide was reduced to ferrocyanide, it was supplemented with 2mL of 1% trichloroacetic acid and 2% FeCl3 and left for 20 min. Absorbance was read at 700 nm to determine the amount of ferric ferrocyanide (Prussian blue) formed. Higher absorbance of the reaction mixture indicates higher reducing power of the sample. ISSN: 0975-8585 September October 2016 RJPBCS 7(5) Page No. 1415 Inhibition Percentage % = [(à °Ã‚ Ã‚ Ã‚ ´blank à ¢Ã‹â€ Ã¢â‚¬â„¢ à °Ã‚ Ã‚ Ã‚ ´sample)]/à °Ã‚ Ã‚ Ã‚ ´blank] ÃÆ'- 100 Determination of Nitric Oxide (NO) Scavenging Activity Nitric oxide production from sodium nitroprusside was measured according to Jagetia 2004 [30]. An equal amount (6 mL) of sodium nitroprusside (5mM) solution was mixed with extracted sample (25mg, 50mg, 100mg and 200mg) and incubated at 25 °C for 180 min. After every 30 min, 0.5 mL of the reaction mixture was mixed with an equal amount of Griess reagent (1% sulphanilamide, 2% phosphoric acid, and 0.1% napthylethylene diamine dihydrochloride), and absorbance was taken at 546 nm and compared with absorbance of 1 mg/mL of standard solution (sodium nitrite) treated in the same way with Griess reagent. Inhibition Percentage % = [(à °Ã‚ Ã‚ Ã‚ ´blank à ¢Ã‹â€ Ã¢â‚¬â„¢ à °Ã‚ Ã‚ Ã‚ ´sample)]/à °Ã‚ Ã‚ Ã‚ ´blank] ÃÆ'- 100. RESULTS AND DISCUSSION Endolichenic fungi are residing in living thalli of lichens and that similar to endophytic fungi asymptomatically in internal tissues of all higher plants [3-5]. In Recently the biology of Endolichenic fungi are renowned to interesting novel sources of biologically active compounds. This study focuses on the biology of endolichenic fungi, their discovery, isolation, identification, and their biological activities in invitro. In our present research, we isolated rare and interesting Endolichenic fungus from crustose type lichen Lecanora spp. (Fig.1) collected from Horsley Hills, Andhra Pradesh. The morphological characters of the isolate were slow-growing, yellow in colour, conidiophores having smooth, lateral branching, conidia aseptate, phialides and ascospores (Fig.3). The ITS sequence of endolichenic fungus 100% similarity with Talaromyces tratensis sequences from Gene-Bank and this endolichenic fungus was identified as Talaromyces tratensis (Fig.3). Previously several endolichenic fungi and their bioactive metabolites [7, 11-13] reported nevertheless Talaromyces tratensis newly reporting to produce and interesting bioactive metabolites with antimicrobial, and antioxidant properties. To our knowledge, this is the first report of this organism as an endolichenic fungi from Lichens. Crude metabolites of the T. tratensis were extracted with ethyl acetate as organic solvent by using solvent extraction procedure. The crude extract was evaluated for antibacterial and antifungal activity against some clinically significant microorganisms following agar well diffusion assay and poison food technique respectively. The metabolites displayed moderate to strong antibacterial activity (Fig. 4) against all the test pathogens. The metabolites showed highest in vitro activity against Klebsiella pneumoniae followed by Escherichiacoli, Salmonella typhi, Proteus vulgaris, Bacillus substiles, Pseudomonas fluorescence and Staphylococcus aureus (Table. 1). In food poison technique for antifungal activity (Fig. 5), it shows 82.59% I highest growth inhibition on Colletotrichum capsisi, followed by Aspergillus niger and Fusarium oxysporium (Table. 2). Table. 1: Antibacterial activity of T. tratensis Name of Bacteria % of growth inhibition at different concentration 25ÃŽÂ ¼l 50ÃŽÂ ¼l 75ÃŽÂ ¼l 100ÃŽÂ ¼l Klebsiella pneumoniae 33.56 57.75 66.63 75.94 Escherichia coli 30.93 56.79 66.75 75.66 Salmonella typhi 30.98 56.32 66.52 74.39 Proteus vulgaris 31.70 55.28 66.00 69.83 Bacillus substiles 31.67 48.06 64.86 72.61 Pseudomonas fluorescence 29.38 49.47 64.95 72.61 Staphylococcus aureus 31.67 48.06 64.86 70.94

Death of a sales man Essay -- essays research papers

No one has a perfect life. Everyone has conflices that they must face sooner or later. The ways in which people deal with these personal conflicts can differ as much as the people themselves. Some insist on ignoring the problem as long as possible, while some attack the problem to get it out of the way.   Ã‚  Ã‚  Ã‚  Ã‚  The book of a Salesman, is written by Arthur Miller. It takes place at Willy Loman’s - A 63 year old once popular salesman who’s lost his popularity and sales, not to mention his mind, small house in New York surrounded by apartments. Biff, a thirty-four year old son of Willy who has been searching for himself while working on farms in the west to the dismay of his father, returns from the west to visit his family although he doesn’t know how long he’s going to stay. Happy, the younger brother of Biff who tries in all he can to please his father and attempts to continue his father’s dream after he dies, is glad to see him, but Willy seems strangely irritated. Willy has a flashbacks time to time. Biff and Happy were promising high school students. Charley, a father who is fairly successful and offers Willy a job which Willy refuses on the basis of pride, comes to Willy’s house at night complaining of not being able to sleep . Charley and Willy play cards, but at the same time, Willy hold a conversation with his imaginary brother. Charley has no idea what’s going on and leaves. Linda tells Biff that Willy has attempted by crashing the car several times. Willy comes out of his reverie and speaks with his family about their jobs. Happy has an idea of starting a line of sporting goods so Biff decides to go to Bill Oliver to ask to borrow money. Willy decides to go to Howard the next day to ask if he can work in New York so that he wouldn’t have to drive 700 miles to work.. The next day Willy goes to Howard and Biff goes to see Oliver. They decide to celebrate their success by going out for dinner at night. Biff confronts Willy about his attempts and Willy denies everything. He tells Biff that he did not get any money from Oliver and has no hope go get any money. He accuses Willy of not know who he really is. However, after this, Biff cries and leaves. Willy realizes that Biff loves him and de cides to celebrate by himself by crashing the car which would give his family twenty-thousand dollar in life insurance. No one but his family and... ...f, when he couldn’t even afford to buy his wife new ones. Another secret is when Linda finds out that Willy’s trying to kill himself. She doesn’t let Willy know that she found out, so she’s letting the problem go on, instead of fixing it. In Act One, page 59, Linda states, â€Å"I was looking for a duse. The lights brew out, and I went down the cellar. And behind the fuse box---it happened to fall out--was a length of rubber pipe--just short......And sure enough, on the bottom of the water heater there’s a new little on the gas pipe....Everyday I go down and take away that little rubber pipe. But when he comes home, I put it back where it was.† Happy lies constently about everything and anything. An example is when they were at the resturant and he met some s. He told the s that Willy wasn’t his father. Charley’s family has an open relationship. Charley taught Bernard to be honest.   Ã‚  Ã‚  Ã‚  Ã‚  Third, there’s appearanceWilly’s family shared the need to be well liked, and wanted to have the personalities to â€Å"win friends and influence people,† Willy tried to make sure his â€Å"image† presented an air of leadership and success, but was more passive than he wanted to appear.

Finding Neverland :: essays research papers

â€Å"I don’t want a breeze of doubt. We must get that kite in the air.†   Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Johnny Depp (Finding Neverland)   Ã‚  Ã‚  Ã‚  Ã‚  Ingenuity—the word that describes what J.M. Barrie possessed that paved the way for Peter Pan, and the same word that exemplifies the reason why successful entrepreneurs have gotten to where they are now.   Ã‚  Ã‚  Ã‚  Ã‚  J.M. Barrie, armed with the child that was always alive in him, revealed the transformative power of one’s imagination, that as long as you believe, you can transform yourself into something greater. He had the extraordinary ability to take people to another world—an enchanting world past tears and fears that exists only in fantasy and beyond one’s limits, and where imagination is the only key.   Ã‚  Ã‚  Ã‚  Ã‚  Entrepreneurs too have a knack for great things. They come up with great ideas which they execute better than anyone else. They have the flair to seek opportunities, take risks, and then afterwards, fulfill potentials that nobody else sees. The real entrepreneur has the drive to succeed and despite failures, doesn’t stop. Heck, he never stops even if he already has succeeded. The real entrepreneur breaks new grounds, just as Barrie did.   Ã‚  Ã‚  Ã‚  Ã‚  Barrie’s imagination took him to places which he otherwise would never have experienced. As participants of SOMBA who are in our first step in creating a new business, we have to utilize our imagination and be as creative as possible in order to come up with a good business idea. We have to think outside the boundaries and look beyond what’s right in front of us. If we are to become entrepreneurs, thinking just like everybody else is not an option. Like J.M. Barrie, we always have to keep an open mind for brilliant ideas, may it be outside or inside the confines of our own bedrooms. Having an active imagination, after all, does not just stop. The ideas would keep on coming—whether feasible or farfetched.   Ã‚  Ã‚  Ã‚  Ã‚  More than this though, starting our own business requires not just the business idea itself but also the right attitude. Barrie knew his other plays weren’t good enough but he didn’t stop writing because he wanted to do better and believed that he could. His play, Peter Pan, was a result of not sheer talent, but also of dreaming big—every success story after all starts with big dreams, determination—simply dreaming and not really doing anything will lead to nowhere, passion—loving not just the concept but doing the actual dirty work, faith—believing that the goal is within one’s reach, and of course, a little bit of craziness.

Germany in Ww Essay

History Department Year 10 World War 1 – World War 2 Written Research Assignment The weaknesses of Germany’s opponents were equally responsible for Hitler’s military successes as his Blitzkrieg tactics between 1939-1941. The Blitzkrieg tactics were very effective during the Second World War but this was also partly due to the fact that the Allied generals and tacticians were so incompetent. The fact that Blitzkrieg and the incompetency of opposition generals were equally responsible for Hitler’s military successes is best shown in his campaigns in Poland, France and Russia. In these conflicts the largest deciding factors were the Blitzkrieg tactics and the incompetency of the opposition generals. Blitzkrieg won the day in all of these conflicts but, as was shown in the later years of the war, once the Allies had competent generals the Blitzkrieg tactics were defeated. One of Hitler’s largest military successes between 1939 and 1941 was the campaign in Poland. The Campaign in Poland was an immensely easy victory for the Germany War machine. The Polish Army was large and well trained, but it was immensely outdated. They still had a large amount of cavalry regiments in there army which were completely destroyed by German tanks. They had very few tanks of their own and those that they did have were nothing compared to the strength of the German Panzers. They had quite a large well trained infantry but many of them still used swords and their guns were completely outclassed by the German assault rifles. They also had a small and rather average air force but this was made obsolete by the larger and better German air force. Also Poland is a flat country and it had few natural obstacles making it ‘ideal tank country’ [ (Crisp, 1990) ]and therefore the perfect target for Blitzkrieg. As well as the actual Polish army, the tactics and generals of the Polish were also very outdated. When the time came for battle The Polish Generals arranged their army into the Standard and age old line formation. When the Armies met the Blitzkrieg tactics worked perfectly due to this arrangement and the Polish were defeated with ease. As shown here the Blitzkrieg tactics and fail Polish generals result were equally responsible for Germany’s success. As Peter Crisp said in his book, Blitzkrieg, ‘Geographically and strategically, Poland was the perfect target for a Blitzkrieg attack. ’ [ (Crisp, 1990) ] The Blitzkrieg tactics were responsible for the actual win but if Poland had had more competent generals they had made better defences for the Blitzkrieg style of attack and had ditched the cavalry and upgraded and enlarged their tank and air forces they would have been able to repel the Germans and their Blitzkrieg. That is why the Blitzkrieg tactics and weak opponents were equally responsible for Hitler’s military success. Another of Hitler’s early military success was his campaign in France, also known as operation Sicklecut. This is due to the way the main force was supposed to punch through a hole in French defences and cut around like the cut of a sickle to attack the French forces from the rear. The main French forces were supposed to be distracted be a diversionary German force. This plan worked perfectly and the main German for Force smashed into the rear of the French force where together they pushed the French and supporting British armies into the coast in a thorough defeat. The Germans then pushed through to Paris where after a mass evacuation of the crumbling French forces Germany took control of Paris. This is a great example of the fact that Hitler’s military success was due equally due to the Blitzkrieg tactics as the incompetency of his opposition. In the campaign in France the Blitzkrieg tactics were very effective, not just beating the French army but spreading panic throughout the country and forcing the chain of command to crumble, but it could have and would have been defeated if it wasn’t for the useless generals of the French army. The Panic caused by the Blitzkrieg tactics was a very effective weapon for the Germans, one unknown French soldier even recounted in his diaries that his saw own comrades running ‘with their hands over their heads not bothering to even return fire’ [ (Trueman, 2000) ]. The French had the capabilities to defeat the Germans and their Blitzkrieg tactics but they stuffed it up. Most of the Generals were veterans of the First World War and they were using the same tactics as they did then. Towards the end of his life Marshal Petain, the commander-in-chief of the French armies, said ‘After the war of 1914-1919, it was finished for me. My military mind was closed. When I saw the introduction of other tools and other methods I must say they didn’t interest me,’ [ (Crisp, 1990) ] showing exactly the attitude of the French military leadership at the start of the War. This allowed the Germans to defeat them with ease. They believed that the Germans would use the same plan that they used in the First World War and easily were defeated by the superior tactics of the Germans and when the Germans continued their advance through France and were bearing upon Paris in a matter of the days the French Leadership started to breakdown. If the French generals had been more competent they could have used their own tanks and air force more effectively and then the Germans would have been defeated and the French would have been successful. The Campaign in Russia, also known as Operation Barbarossa, named after the twelfth century Prussian King who was prophesied to rise from his grave and restore Germany to world power, is another great example of the fact that Hitler’s military successes were equally due to his Blitzkrieg tactics and the ineptitude of his opposition. The Campaign in Russia started out as what seemed to be a complete annihilation. ’ When Operation Barbarossa opened, on 22 June 1941, the Soviets were taken completely by surprise. ’ [ (Crisp, 1990) ] The German army was rapidly advancing and defeating the Red Army with ease. The Red Army had huge numbers of men and many tanks and aircraft but most of these tanks were obsolete and the Air force was built mainly for tactical air support, not for air superiority. The main problem for the Red Army was the leader of Russia, Josef Stalin. After Stalin and his brutal Communist regime’s murder of all of the senior officers for political reasons and the strict constrictions placed on the remaining young and inexperienced officers which meant there was no room innovation during the heat of battle leaving the Red Army incredibly handicapped. At the beginning of operation Barbarossa ‘Stalin refused to believe the invasion was really happening. He thought the attack was a provocation by a German commander acting independently of Hitler, and ordered his frontline soldiers not to fire back’ [ (Crisp, 1990) ]. The fact that Hitler’s military success required both a weakness of Hitler’s opposition and the Blitzkrieg tactics is best shown in the next part of the campaign in Russia. Once Stalin finally allowed his officers some flexibility and the winter allowed them to build many more of their new T-34 model tanks the Russians started to come back. After a period of intense fighting, particularly around Stalingrad, the Germans were defeated and forced to retreat and as General Mellenthin of the Germans wrote ‘with the failure of our supreme effort, the strategic initiative passed to the Russians. ’ [ (Crisp, 1990) ] This shows how necessary the weakness of Hitler’s enemies for his military success due to the fact that the second one of his enemies obtained good weapons, like the T-34, and successful leaders the Germans Blitzkrieg tactics were neutralised and they were defeated. The Blitzkrieg tactics and the weakness of Hitler’s opposition were equally responsible for Hitler’s military success between 1939 and 1941 during the Second World War. Without the Blitzkrieg tactics the German Army simply would not have been able to defeat the Allied forces and without weaknesses of Germany’s opposition the Blitzkrieg tactics would have been defeated by the superior enemy forces. The areas of the war which best show this are the campaigns in Poland, France and Russia. In all of these operations Blitzkrieg and inferior opposition played a major part. This is why the Blitzkrieg tactics and weak opposition were equally responsible for Hitler’s Military success. Bibliography Crisp, P. (1990). Blitzkrieg. Wayland publishing. A very good source. Lots of good information and quotes on all necessary areas. Deighton, L. (1979). Blitzkrieg. Pluriform Publishing. An alright source. Some good info but no quotes Trueman, C. (2000). Blitzkrieg. Retrieved May 2010, from History Learning Site: http://www. historylearningsite. co. uk/blitzkrieg. htm A good source. Not a lot of information but some good quotes Unknown Author/Date. Barbarossa. Retrieved May 2010, from World War 2 Database: http://worldwar2database. com/html/barbarossa. htm A good source. Not many quotes but a good source of info Unknown Author/Date. France. Retrieved May 2010, from World War 2 Database: http://worldwar2database. com/html/france_40. htm A good source. Not many quotes but a good source of info Unknown Author/Date. Blitzkrieg. Retrieved May 2010, from World War 2 Database: http://www. 2worldwar2. com/blitzkrieg. htm A alright source. Not many quotes and an alright source of info W